![]() |
The Nature
Institute Home | Our Education Programs | Our Publications | Content Areas | Writings Ordered by Author | Resources and Links | Contact Us | Search |
|
On Making the Genome Whole
Getting Over the Code Delusion: Biology’s Awakening Stephen L. Talbott This document: http://natureinstitute.org/txt/st/mqual/genome_4.htm. This essay is part of a work in progress and is subject to continual revision. Original publication: February 18, 2010. Date of last revision: August 30, 2010. Copyright 2010 The Nature Institute. All rights reserved. You may freely redistribute this chapter for noncommercial purposes only. By clicking on the shaded rectangles at the end of many scientific terms, you can immediately read a definition of the terms in a separate window. This requires JavaScript to be enabled in your browser.
Preface: The epigenetic revolution I’ve been writing about for the past year is slowly but surely making its way into the popular media — witness the recent Time magazine cover story, "Why DNA Isn’t Your Destiny". The shame of it is that most of the significance of the current research is still being missed. Judging from much that is being written, one might think the main thing is simply that we’re gaining new, more complex insights into how to treat the living organism as a manipulable machine. After my previous, fairly technical surveys of some of the work going on in genetics and epigenetics, I offer here a more readable and widely accessible summary, including a great deal of new material. Part of my aim is to provide some of the perspective that is missing from the mainstream reports. The central truth arising from genetic research today, I believe, is that the hope of finding an adequate explanation of life in terms of inanimate, molecular-level machinery was misconceived. There are no such mechanisms in the living organism at any level. Just as we witness the distinctive character of life when we observe the organism as a whole, so, too, we encounter that same living character when we analyze the organism down to the level of molecules and genes. One by one every reliable and predictable "molecular mechanism" has been caught deviating from its program and submitting instead to the fluid life of its larger context. And chief among the deviants is that supposed First Cause, the gene itself.
WHEN IT EMERGED A FEW YEARS AGO
that humans and chimpanzees shared, by some measures, 98 or 99 percent of
their DNA Such was the fretting on the human side, anyway. To be truthful, the chimps didn’t seem much interested. And their disinterest, it turns out, was far more fitting than our angst.
In 1992 Nobel prizewinning geneticist Walter Gilbert wrote that you and I
will hold up a CD containing our DNA sequence ATGCGATCTGTGAGCCGAGTCTTTAAGTTCATTGACATGCCAACAGAAGGTAAACCT
It’s true that the code, as it was understood at the height of the genomic
era, had some grounding in material reality. Each of the four
different letters represented one of the four nucleotide bases Certainly the idea seemed powerful to those who were enamored of it. In their enthusiasm they gave us countless cellular mechanisms and one revolutionary gene discovery after another — a gene for cancer, a gene for cystic fibrosis (excerpted above), a gene for obesity, a gene for depression, a gene for alcoholism, a gene for sexual preference . . . Building block by building block, genetics was going to show how a healthy human being could be constructed from mindless, indifferent matter.
And yet the most striking thing about the genomic As minor tokens of the changing consciousness among biologists, one could cite articles from this past year in the world’s two premier scientific journals, each reflecting upon the discovery of the "gene for cystic fibrosis". THE PROMISE OF A CURE: 20 YEARS AND COUNTING — so ran the headline in Science, followed by this slightly sarcastic gloss: "The discovery of the cystic fibrosis gene brought big hopes for gene-based medicine; although a lot has been achieved over two decades, the payoff remains just around the corner" (Couzin-Frankel 2009). An echo quickly came from Nature, without the sarcasm: ONE GENE, TWENTY YEARS — "When the cystic fibrosis gene was found in 1989, therapy seemed around the corner. Two decades on, biologists still have a long way to go" (Pearson 2009). The story has been repeated for one gene after another, which may be part of the reason why molecular biologist Tom Misteli offered such a startling postscript to the unbounded optimism of the Human Genome Project. "Comparative genome analysis and large-scale mapping of genome features", he wrote in the journal Cell, "shed little light onto the Holy Grail of genome biology, namely the question of how genomes actually work" in living organisms (Misteli 2007).
But is this surprising? The human body is not a mere implication of clean
logical code in abstract conceptual space, but rather a play of complexly
shaped and intricately interacting physical substances and forces. Yet
the four genetic letters, in the researcher’s mind, became curiously
detached from their material matrix. In many scientific discussions it
hardly would have mattered whether the letters of the "Book of Life"
represented nucleotide bases The misdirection in all this badly needs elaborating — a task I hope to advance here. As for the differences between humans and chimpanzees, the only wonder is that so many were exercised by it. If we had wanted to compare ourselves to chimps, we could have done the obvious and direct and scientifically respectable thing: we could have observed ourselves and chimps, noting the similarities and differences. Not such a strange notion, really — unless one is so transfixed by a code abstracted from human and chimp that one comes to prefer it to the organisms themselves — the organisms that are the only possible source for whatever legitimacy and physical meaning the abstraction possesses. I’m not aware of any pundit who, brought back to reality from the realm of code-fixated cerebration, would have been so confused about the genetic comparison as to invite a chimp home for dinner to discuss world politics. If we had been looking to ground our levitated theory in scientific observation, we would have known that the proper response to the code similarity in humans and chimps was: "Well, so much for the central, determining role we’ve been assigning to our genes". Thankfully, that seems to be where biology is getting to these days. We are progressing into a post-genomic era — often referred to as the era of epigenetics. Paradoxes
"Epigenetics" most commonly refers to heritable changes in gene activity
not accounted for by alterations or mutations in the actual DNA
Historically, an intellectual recoiling from this necessity was what led
to an overly narrow concept of the genetic code
A number of apparent paradoxes helped to nudge the molecular biologist
toward a more contextualized understanding of the gene
A second oddity centered on the fact that, upon "deciphering" the genetic
Book of Life, we found that our coding scheme made the vast bulk of it
read like nonsense. That is, some 95 or 98 percent of human DNA was not a
carrier of the genetic code at all. It was useless for making proteins.
Most of this noncoding
Another paradox — perhaps the most decisive one — was
recognized and wrestled with (and more often just ignored) going back to
the early twentieth century. With few exceptions, every different type of
cell in the human body contains the same chromosomes
The developmental biologist F. R. Lillie, remarking in 1927 on the
contrast between "genes which remain the same throughout life" and a
developmental Think for a moment about this ordered developmental stream. When a cell of the body divides, the daughter cells can be thought of as "inheriting" traits from the parent cell. The puzzle about this cellular-level inheritance is that, especially during the main period of an organism’s development, it leads to a dramatic, highly directed differentiation of tissues. For example, embryonic cells on a path leading to heart muscle tissue become progressively more specialized. The changes each step of the way are "remembered" (that is, inherited) — but what is remembered is caught up within a process of continuous change. During development you cannot say that "every cell reproduces after its own likeness".
Over successive generations, cells destined to become a particular type
lose their ability to be transformed into any other tissue type. And so
the path of differentiation
Cells of the mature heart and brain, then, have inherited entirely
different destinies, but the difference in those destinies was not written
in their DNA sequences
So what’s going on? The paradoxes mentioned above turn out to be
intimately related. One strong hint pointing toward their resolution lay
in the fact that, as organisms rise on the evolutionary scale, they tend
to have more "junk DNA". Noncoding
That suspicion has now become standard doctrine — a still
much-too-simplistic doctrine, if one stops there, however. For noncoding
as well as coding DNA sequences continue unchanged throughout the
organism’s entire trajectory of differentiation We need a more living understanding. It is not only that noncoding DNA is by itself inadequate to regulate genes. What we are finding is that at the molecular level the organism is so dynamic, so densely woven and multidirectional in its causes and effects, that it cannot be explicated as living process through any strictly local investigations. When it begins to appear that "everything does everything to everything" (Dumont and Maenhaut 2001), the search for "regulatory control" necessarily leads to the unified and irreducible functioning of the cell and organism as a whole. The Dynamic Chromosome
The usual formula has it that DNA
The enzyme that transcribes Or so the usual story runs — which is more or less correct as far as it goes. But let’s look at some of what else must go on in order to make the story happen.
If you arranged the DNA in a human cell linearly, it would extend for
nearly two meters. How do you pack all that DNA into a cell nucleus
Obviously it must be possible, however difficult to conceive — and
in fact an endlessly varied packing and unpacking is going on all the
time. The first thing to realize is that chromosomes do not consist of
DNA only. Their actual substance, an intricately woven structure of DNA,
RNA, and protein, is referred to as "chromatin"
But that’s just the first level of packing; it accounts for relatively
little of the overall condensation of the chromosomes. If you twist a
long, double-stranded rope, you will find the rope beginning to coil upon
itself, and if you continue to twist, the coils will coil upon themselves,
and so on without particular limit, depending on the fineness and length
of the rope. Something like this supercoiling
With that background, we can gain our first glimpse of the concerted
dynamism in which genes participate. At any one time — and with the
details depending on the tissue type and stage of the organism’s
development
The supercoiling has another direct, more localized role in gene
expression
Recall, then, that the enzyme responsible for transcribing DNA Picture the situation concretely. Every bodily activity or condition presents its own requirements for gene expression. Whether you are running or sleeping, starving or feasting, getting aroused or calming down, suffering a flesh wound or recovering from pneumonia — in all cases the body and its different cells have specific, almost incomprehensibly complex and changing requirements for differentiated expression of thousands of genes. And one thing necessary for achieving this expression in all its fine detail is the properly choreographed performance of the chromosomes. This performance cannot be captured with an abstract code. Interacting with its surroundings, the chromosome is as much a living actor as any other part of its living environment. Maybe instead of summoning the image of a rope, I should have invoked a snake, coiling, curling, and sliding over a landscape that is itself in continual movement. The Dynamic Space of the Cell Nucleus
The chromosome
Chromosome domains are also established by the twisting forces (torsion)
communicated more or less freely along bounded segments of the chromosome.
The loci within such a region share a common torsion, and this can attract
a common set of regulatory proteins. The torsion also tends to correlate
with the level of compaction of the chromatin There are still other ways that the chromosome reveals itself as a dynamic, complexly structured context. Genes expressed in the same cell type or at the same time, genes sharing common regulatory factors, and genes actively expressed (or mostly inactive) tend to be grouped together. One way such domains could be established is through the binding of the same protein complexes along a region of the chromosome, thereby establishing a common molecular and regulatory environment for the encompassed genes. But it’s important to realize that, like so much in the fluid, living cell, such regions are more a matter of tendency than of absolute rule.
So far we’ve been looking only at the structure of the chromosome itself.
But organization at one level of an organism never makes sense except so
far as it reflects organization at other levels. The structured
chromosome can fulfill its tasks only by participating in —
mirroring and being mirrored by — a structured nucleus
Every chromosome occupies a characteristic region of the nucleus — a
"chromosome territory"
For local regions of a chromosome, this effect of location can be finely
tuned to a degree and in ways that currently baffle all attempts at
understanding. Spurred by as yet unknown signals and forces, a particular
segment of a chromosome will loop out as an open-chromatin Such chromosome movements, which can be "fast and directed" (Chuang et al. 2006), are now known to bring together genes and regulatory sites on different chromosomes as well — a considerable feat of precise targeting when you consider not only the chromosome-packing problem discussed above, but also the fact that there are billions of nucleotide bases on the human chromosomes. Yet such synchronization of position can be decisive for the expression of particular genes. Looking at all the coordinated looping and dynamic reorganization of chromosomes, one research team concluded: Our observations demonstrate that not only active, but also inactive, genomic
So context indeed matters. Moreover, the relevant organization of the
cell nucleus involves much more than the chromosomes themselves. There
are so-called "transcription factories" within the nucleus where looping
chromosome segments, appropriate regulatory proteins, transcribing
Other nuclear functions beside transcription also seem to be localized in
this way. But all these specialized locales lack rigid or permanent
structure, and are typically marked by rapid turnover of molecules
(Osborne et al. 2004; Wachsmuth et al. 2008). It’s almost as if one were
looking at something like standing waves in the nucleus. In any case, the
lack of well-defined structure in these functional locations contrasts
with the cell cytoplasm
How the cell manages all these movements in order to bring about just the
right expression of just the right genes is hard to fathom. A fairly
recent surprise has been the discovery of actin
With so much concerted movement going on — not to mention the
coiling
Some topoisomerases cut just one strand of the double helix
In sum: the chromosome is engaged in a highly effective spatial
performance. It is a living, writhing, gesturing expression of its
cellular environment, and the significance of its gesturing goes far
beyond the negative requirement that it be condensed and kept free of
tangles. If the organism is to survive, chromosome movements must be
well-shaped responses to sensitively discerned needs, resulting in every
gene being expressed Metamorphosis of the Code
It’s not just that DNA
It happens, for example, that certain nucleotide bases Part of the problem lies in the mechanistic mindset that always looks for the mere aggregation of parts, as if the methyl group and nucleotide base were discrete Lego blocks added together, one as a tag upon the other. But wherever chemical bonds are formed or broken, we see a true transformation of matter. The result is not a mere aggregation or mixture of the substances that came together, but something entirely new, with entirely different qualities and a different constellation of forces.
So to think of a methylated cytosine
We are now learning about the extreme consequences of these metamorphoses.
In the first place, the transformations of structure brought about by
methylation can render DNA locations no longer accessible to the protein
transcription factors
It would be difficult to overstate the pervasive role of DNA methylation
Some patterns of DNA methylation are heritable, leading to a kind of
Lamarckian inheritance
In general, then, the slate upon which all the developmental
This structuring and restructuring of DNA by the surrounding life
processes is fully as central to a developing organism as the
code-conforming DNA sequence Countless other molecular interactions play a transformative role with DNA, a few of which will be glancingly touched on below. DNA’s Many Languages
We have seen that chromosomes
Each nucleosome
Further, not only the exact position of a nucleosome on the double helix,
but also the precise rotation of the helix on the nucleosome is
important. "Rotation" refers to which part of the DNA faces toward the
nucleosome surface and which part faces outward. Depending on
orientation, the nucleotide bases will be more or less accessible to the
various activating
The shape of a stretch of DNA matters in a different way as well. There
are two grooves (the major This discovery of the role of the minor groove also helps to solve a puzzle. "The ability to sense the variation in electrostatic potential in DNA", according to bioinformatics researcher Tom Tullius, "may reveal how a protein could home in on its binding site in the genome without touching every nucleotide" — of which there are billions in every set of human chromosomes. The lesson in all this, Tullius suggests, has to do with what we lose when we simplify DNA to "a one-dimensional string of letters". After all, "DNA is a molecule with a three-dimensional shape that is not perfectly uniform" (Tullius 2009). It’s remarkable how readily the historical shift from direct observation of organisms to instrumental read-outs of molecular-level processes encouraged a forgetfulness of material form and substance in favor of abstract codes fit for computers.
Distinct combinations of nucleotide bases
Another research team, based in Europe, looked at several different
hormone-responding transcription factors. They concluded not only that
the DNA sequences to which these proteins were bound imparted
conformational changes to the proteins, but also that these changes led to
selective recruitment of different co-regulators and perhaps even to
distinct restructurings of the local chromatin
The influence of form works in the other direction as well: the bound
protein can transform the shape of DNA in a decisive way, making it easier
for a second protein to bind nearby, even without any direct
protein-protein interactions. In the case of one gene relating to the
production of interferon (an important constituent of the immune system),
"eight proteins modulate [DNA] binding site conformation and thereby
stabilize cooperative assembly without significant contribution from
interprotein interactions" (Moretti et al. 2008). As a result of this
intricate cooperation of proteins and DNA, mediated by the shifting
structure of the double helix And so, despite the fact that "DNA is often mistakenly viewed as an inert lattice" onto which proteins bind in a sequence-specific way (Chaires 2008), the fact of the matter is altogether different. Proteins and DNA are caught up in a continual conversation of mutual influence and qualitative transformation.
On yet another front: the genetic code consists of sixty-four distinct
codons
"Synonymous mutations
They found that, in the bacterium Escherichia coli, these genes
differed in expression, with the highest-expressing form producing 250
times as much protein as the lowest-expressing form. Bacterial growth
rates also varied. The researchers determined that the choice of
synonymous codons affected the folding structure of the resulting RNA "Synonymous" in the narrow terms of code does not mean "synonymous" so far as the molecular sinews of life are concerned.
Finally and most generally: scientists using computers to scan the several
billion nucleotide bases of the human genome
It’s also producing a growing awareness that what we inherit (and what
makes a difference to evolution) is as much a matter of three-dimensional
structure as it is of nucleotide But the emerging point of view holds that architecture can matter as much as sequence. As bioinformatics researcher Elliott Margulies and his team at the National Human Genome Research Institute put it, "the molecular shape of DNA is under selection" — a shape that can be maintained in its decisive aspects despite changes in the underlying sequence. It’s not enough, they write, to analyze "the order of A’s, C’s, G’s, and T’s" because "DNA is a molecule with a three-dimensional structure" (Parker et al. 2009). Elementary as the point may seem, it’s leading to a considerable reallocation of investigative resources. Of course, researchers knew all along that DNA and chromatin were spatial structures. But that didn’t prevent them from ignoring the fact as far as possible. Opportunities to pursue the abstract and determinate lawfulness of a code or mathematical rule have always shown great potential for derailing the scientist’s attention from the world’s full-bodied presentation of itself. Achieving logical and mathematical certainty within a limited sphere can seem more rigorously scientific than giving attention to the metamorphoses of form and rhythms of movement so intimately associated with life. These latter require more aesthetically informed cognitive capacities, and they put us at greater risk of having to acknowledge the evident expressive and highly concerted organization of living processes. When you encounter the meaningful, directed, and well-shaped movements of a dance, it’s hard to ignore the active principle — some would say the agency or being — coordinating the movements. And nowhere do we find the dance more evident than in the focal performance of the nucleosome. The Sensitive Nucleosome
I have referred to nucleosomes Here it is well to remember one of the primary lessons of twentieth-century physics: we are led disastrously astray when we try to imagine atomic- and molecular-level entities as if they were tiny bits of the stuff of our common experience. The histone spool of nucleosomes, for example, is not some rigid thing. It would be far better to think of its "substance", "surface", "contact points", and "physical interactions" as forms assumed by mutually interpenetrating forces in their intricate and infinitely varied play. In any case, the impressive enactments of form and force about the nucleosome are surely central to any understanding of genes. The nucleosome is rather like a maestro directing the genetic orchestra, except that the direction is itself orchestrated by the surrounding cellular audience in conversation with the instrumentalists. The nucleosome is simply where the conversation comes to what may be its most vivid focus. In order to get a sense for the shape of the exchange, you will need a few details.
The canonical nucleosome spool is a complex of protein histones, each of
which has a flexible, filamentary "tail"
After a few histone tail modifications But this was to ignore the nearly infinite variety of all those contextual factors that blend their voices in concert with the histone modifications. In the plastic organism, what goes on at the local level is always shaped and guided by a larger, coherent context — a context that surely has meaning, but never an absolutely fixed grammar. And, in fact, while overwhelming evidence for a meaningful, gene-regulatory conversation involving histone modifications has emerged, there is little to suggest a rigid code. Shelley Berger of Philadelphia’s Wistar Institute, noting that a single tail modification "recruits numerous proteins whose regulatory functions are not only activating but also repressing" and that "many of these marks have several, seemingly conflicting roles", summarizes the situation this way: Although [histone] modifications were initially thought to be a simple code, a more likely model is of a sophisticated, nuanced chromatin And (leaving aside the jarring reference to building blocks) how could it be otherwise? Each histone tail modification re-shapes the physical and electrical structure of the local chromatin, shifting the pattern of interactions among nucleosome, DNA, and associated protein factors. To picture this situation concretely — as opposed to remaining within the straightjacket of code — is immediately to realize that it cannot be captured in purely digital terms. A sculptor does not try to assess the results of a stroke of the hammer as a choice among the possibilities of a digital logic. Berger envisions histone modifications as participating in "an intricate 'dance' of associations".
There is much much more. The histones making up a nucleosome spool can
themselves be exchanged for noncanonical, or variant
Everything depends on contextual configurations that we can reasonably
assume are as complex, nuanced, and expressively manifold as the gestural
configurations available to a stage actor. Further, the nucleosome
positioning pattern and other dynamics vary throughout a genome depending
on tissue type, stage of the cell life cycle, and the wider physiological
environment. They vary between genes that are more or less continuously
expressed and those whose expression level changes with environmental
conditions (Tirosh and Barkai 2008; Choi and Kim 2009). They vary between
open The Nucleosome as Mediator
Seemingly in the grip of the encircling DNA
Nucleosomes will sometimes move — or be moved (the distinction
between actor and acted upon is forever obscured in the living cell)
— rhythmically back and forth between alternative positions in order
to enable multiple transcription
But quite apart from stem cells, it is increasingly appreciated that
nucleosomes play a key role in holding a balance between the active and
repressed states of many genes. As the focus of a highly dynamic
conversation involving histone variants, histone tail modifications, and
innumerable chromatin-associating proteins, decisively placed nucleosomes
can (as biologist Bradley Cairns writes) maintain genes "poised in the
repressed state", and "it is the precise nature of the poised state that
sets the requirements for the transition to the active state". Among
other aspects of the dynamism, there is continual turnover of the
nucleosomes themselves — a turnover that allows transcription
factors With another sort of rhythm the DNA around a nucleosome spool "breathes", alternately pulling away from the spool and then reuniting with it, especially near the points of entry and exit. This provides what are presumably well-gauged, fractional-second opportunities for gene-regulating proteins to bind to their target DNA sequences during the periods of relaxation.
During the actual process of transcription
Such, then, is the sort of intimate, intricate, well-timed choreography
through which our genes come to their proper expression Facing Up to Life Of all the broad topics comprising the field of genetic and epigenetic research, we have looked at very few — and not even the ones most dramatically undermining the doctrine that "genes are mechanisms of destiny". But it is enough, I hope, to suggest why researchers are so energized and excited today. . literature would be good here. A sense of profound change seems to be widespread.
The one decisive lesson I think we can draw from the work in molecular
genetics over the past couple of decades is that life does not
progressively contract into a code or mechanism or any other reduced
"building block" as we probe its more minute dimensions. Trying to define
the chromatin The search for precise explanatory mechanisms and codes leads us along a path of least resistance toward the reduction of understanding. A capacity for imagination (not something many scientists are trained for today) is always required for grasping a context in meaningful terms, because at the contextual level the basic data are not things, but rather relations, movement, and transformation. To see the context is to see a dance, not merely the bodies of the individual dancers. The hopeful thing is that molecular biologists today — slowly but surely, and perhaps despite themselves — are increasingly being driven to enlarge their understanding through a reckoning with genetic contexts. As a result, they are writing "finis" to the misbegotten hope for a non-lifelike and mechanistic foundation of life, even if the fact hasn’t yet been widely announced. It is, I think, time for the announcement. There is a frequently retold story about a little old lady who claims, after hearing a scientific lecture, that the world is a flat plate resting on the back of a giant tortoise. When asked what the turtle is standing on, she invokes a second turtle. And when the inevitable follow-up question comes, she replies, "You’re very clever, young man, but you can’t fool me. It’s turtles all the way down". As a metaphor for the scientific understanding of biology, the story is marvelously truthful. In the study of organisms, "It’s life all the way down". References Albrethsen, Jakob, Jaco C. Knol and Connie R. Jimenez (2009). "Unravelling the Nuclear Matrix Proteome", Journal of Proteomics vol. 72, no. 1 (Feb. 15), pp. 71-81. doi:10.1016/j.jprot.2008.09.005 Berger, Shelley L. (2007). "The Complex Language of Chromatin Regulation During Transcription", Nature vol. 447 (May 24), pp. 407-12. Brown, Valerie (2008). "Environment Becomes Heredity" (July 14), available online at http://www.miller-mccune.com/article/environment-becomes-heredity. Cairns, Bradley R. (2009). "The Logic of Chromatin Architecture and Remodelling at Promoters", Nature vol. 461 (Sep. 10), pp. 193-8. doi:10.1038/nature08450 Cavellán, Eric (2006). "Chromatin Remodelling in Pol I and III Transcription", thesis, Universitet Stockholms. Doctoral thesis, available at http://su.diva- portal.org/smash/record.jsf?searchId=2&pid=diva2:200808 Chaires, Jonathan B. (2008). "Allostery: DNA Does It Too", ACS Chemical Biology vol. 3, no. 4 (epublication: April 18), pp. 207-8. doi:10.1021/cb800070s Choi, Jung Kyoon and Young-Joon Kim (2009). "Intrinsic Variability of Gene Expression Encoded in Nucleosome Positioning Sequences", Nature Genetics (advance epublication: Mar. 1). doi:10.1038/ng.319 Chuang, Chien-Hui, Anne E. Carpenter, Beata Fuchsova et al. (2006). "Long-range Directional Movement of an Interphase Chromosome Site", Current Biology vol. 16 (Apr. 18), pp. 825-31. doi:10.1016/j.cub.2006.03.059 Costa, Fabrício (2008). "Non-coding RNAs, Epigenetics and Complexity", Gene vol. 410, pp. 9-17. doi:10.1016/j.gene.2007.12.008 Couzin-Frankel, Jennifer (2009). "The Promise of a Cure: 20 Years and Counting", Science vol. 324 (June 19), pp. 1504-7. Dineen, David G., Andreas Wilm, Pádraig Cunningham and Desmond G. Higgins (2009). "High DNA Melting Temperature Predicts Transcription Start Site Location in Human and Mouse", Nucleic Acids Research vol. 37, no. 22, pp. 7360-7. doi:10.1093/nar/gkp821 Dumont, Jacques E., Fréderic Pécasse and Carine Maenhaut (2001). "Crosstalk and Specificity in Signalling: Are We Crosstalking Ourselves into General Confusion?", Cellular Signalling vol. 13, pp. 457-63. Gan, Qiong, Tadashi Yoshida, Oliver G. McDonald et al. (2007). "Concise Review: Epigenetic Mechanisms Contribute to Pluripotency and Cell Lineage Determination of Embryonic Stem Cells", Stem Cells vol. 25, no. 1, pp. 2-9. doi:10.1634/stemcells.2006-0383 Geserick, Christoph, Hellmuth-Alexander Meyer and Bernard Haendler (2005). "The Role of DNA Response Elements as Allosteric Modulators of Steroid Receptor Function", Molecular and Cellular Endocrinology vol. 236, no. 1-2 (May 31), pp. 1-7. doi:10.1016/j.mce.2005.03.007 Gilbert, Walter (1992). "A Vision of the Grail", in The Code of Codes: Scientific and Social Issues in the Human Genome Project, edited by Daniel J. Kevles and Leroy Hood, pp. 83-97. Cambridge, MA: Harvard University Press. Göndör, Anita and Rolf Ohlsson (2009). "Chromosome Crosstalk in Three Dimensions", Nature vol. 461 (Sep. 10), pp. 212-7. doi:10.1038/nature08453 Grewal, Shiv I. S. and Sarah C. R. Elgin (2007). "Transcription and RNA Interference in the Formation of Heterochromatin", Nature vol. 447 (May 24), pp. 399-406. doi:10.1038/nature05914 Hecht, Jeff (2003). "Chimps Are Human, Gene Study Implies", New Scientist (May 19). Available at http://www.newscientist.com/article/dn3744-chimps-are-human-gene-study- implies.html. Kouzine, Fedor, Suzanne Sanford, Zichrini Elisha-Feil, et al. (2008). "The Functional Response of Upstream DNA to Dynamic Supercoiling in Vivo", Nature Structural and Molecular Biology vol. 15, no. 2 (Feb.), pp. 146-54. doi:10.1038/nsmb.1372 Kudla, Grzegorz, Andrew W. Murray, David Tollervey and Joshua B. Plotkin (2009). "Coding-sequence Determinants of Gene Expression in Escherichia coli", Science vol. 324 (April 10), pp. 255-8. doi:10.1126/science.1170160 Lavelle, Christophe (2009). "Forces and Torques in the Nucleus: Chromatin under Mechanical Constraints", Biochemistry and Cell Biology vol. 87, pp. 307-22. doi:10.1139/O08-123 Lillie, F. R. (1927). "The Gene and the Ontogenetic Process", Science vol. 46, pp. 361-8. Martinez-Campa, Carlos, Panagiotis Politis, Jean-Luc Moreau, et al. (2004). "Precise Nucleosome Positioning and the TATA Box Dictate Requirements for the Histone H4 Tail and the Bromodomain Factor Bdf1", Molecular Cell vol. 15 (July 2), pp. 69-81. McCabe, Linda L. and Edward R. B. McCabe, DNA: Promise and Peril. Berkeley CA: Univ. of Calif. Press, 2008. I take the quotation from a book review, "Epigenetic Determinism", by Michael A. Goldman, Science vol. 325, p. 816. doi:10.1126/science.1175293 Meijsing, Sebastiaan H., Miles A. Pufall, Alex Y. So et al. (2009). "DNA Binding Site Sequence Directs Glucocorticoid Receptor Structure and Activity", Science vol. 324 (April 17), pp. 407-10. doi:10.1126/science.1164265 Misteli, Tom (2007). "Beyond the Sequence: Cellular Organization of Genome Function", Cell vol. 128 (Feb. 23), pp. 787-800. doi:10.1016/j.cell.2007.01.028 Moretti, Rocco, Leslie J. Donato, Mary L. Brezinski et al. (2008). "Targeted Chemical Wedges Reveal the Role of Allosteric DNA Modulation in Protein-DNA Assembly", ACS Chemical Biology vol. 3, no. 4 (epublication April 18). doi:10.1021/cb700258r Osborne, Cameron S., Lyubomira Chakalova, Karen E. Brown et al. (2004). "Active Genes Dynamically Colocalize to Shared Sites of Ongoing Transcription", Nature Genetics vol. 36, no. 10 (Oct.), pp. 1065-71. doi:10.1038/ng1423 Parker, Stephen C. J., Loren Hansen, Hatice Ozel Abaan et al. (2009). "Local DNA Topography Correlates with Functional Noncoding Regions of the Human Genome", Science vol. 324 (April 17), pp. 389-92. doi:10.1126/science.1169050 Pearson, Helen (2009). "One Gene, Twenty Years", Nature vol. 460, no. 7252 (July 9), pp. 165-9. Poulter, M., L. Du, I. Weaver, et al. (2009). "GABAA Receptor Promoter Hypermethylation in Suicide Brain: Implications for the Involvement of Epigenetic Processes", Biological Psychiatry vol. 64, no. 8, pp. 645-52. Riordan, J. R., J. M. Rommens, B. Kerem et al. (1989). "Identification of the Cystic Fibrosis Gene: Cloning and Characterization of Complementary DNA", Science vol. 245, no. 4922 (Sep. 8), pp. 1066-73. Rohs, Remo, Sean M. West, Alona Sosinsky et al. (2009). "The Role of DNA Shape in Protein-DNA Recognition, Nature vol. 461 (Oct. 29), pp. 1248-53. doi:10.1038/nature08473 Simonis, Marieke, Petra Klous, Erik Splinter, et al. (2006). "Nuclear Organization of Active and Inactive Chromatin Domains Uncovered by Chromosome Conformation Capture-on-chip (4C)", Nature Genetics vol. 38, no. 11 (Nov.), pp. 1348-54. doi:10.1038/ng1896 Strahl, B. D. and C. D. Allis (2000). "The Language of Covalent Histone Modifications", Nature vol. 403, no. 6765 (Jan 6), pp. 41-5. doi:10.1038/47412 Tirosh, Itay and Naama Barkai (2008). "Two Strategies for Gene Regulation by Promoter Nucleosomes", Genome Research vol. 18, pp. 1084-91. doi:10.1101/gr.076059.108 Travers, Andrew and Georgi Muskhelishvili (2007). "A Common Topology for Bacterial and Eukaryotic Transcription Initiation?" EMBO Reports vol. 8, no. 2, pp. 147-51. doi:10.1038/sj.embor.7400898 Tullius, Tom (2009). "DNA Binding Shapes Up", Nature vol. 461 (Oct. 29), pp. 1225-6. Wachsmuth, Malte, Maïwen Caudron-Herger and Karsten Rippe (2008). "Genome Organization: Balancing Stability and Plasticity", Biochimica et Biophysica Acta vol. 1783, no. 11 (Nov.), pp. 2061-2079. doi:10.1016/j.bbamcr.2008.07.022 Woelfle, Mark A., Yao Xu, Ximing Qin et al. (2007). "Circadian Rhythms of Superhelical Status of DNA in Cyanobacteria", PNAS vol. 104, no. 47, pp. 18819-24. Steve Talbott :: Getting Over the Code Delusion: Biology’s Awakening |
|
- Back to top |
| About Us | Become a Friend | Bookstore | Contact Us | Search | Calendar of Events | Our Education Programs | Our Publications | Content Areas | Writings Ordered by Author | Resources and Links | Home |